Product Name : Unidentified_7

Species name : Uncultured_13(Uncultured organism clone ELU0111-T274-S-NI_000172/Uncultured organism clone ELU0111-T274-S-NI_000171(100%))

Species/Strain : Species

Phylum : Uncultured organism clone ELU0136-T365-S-NI_000061_Unclassified_p

Sequence :TGCAGCACCTTCACATTTGCCTTGCGGCTAACCTGTTTCCAGATTATTCAAATGCAATTTAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAATGCTTTCGCTTGGCCGCTTACTGTATATCGCAAACAGCGAGTATTCATCGTTTACTGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAGCATCAGTGTCAGTTGCAGTCTAGTGAGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACCACGAATTCCGCCCACCTCTACTGTACTCAAGACTGCCAGTTTCAACTGCAATTTTACGGTTGAGCCGCAAACTTTCACAACTGACTTAACAATCCACCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGATCCTTATTCATATGGTACATACAAAATCCCACACGTGGAATACTTTATTCCCATATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGACTCTCGTCCATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGTTGTCTTGGTGGGCCGTTACCCCGCCAACAAACTAATGGAACGCA

Unidentified_7

$400.00Price