Product Name : Unidentified_32
Species name : Uncultured organism clone ELU0025-T109-S-NIPCRAMgANa_000535/ Uncultured bacterium clone K503 (99.83%)
Species/Strain : Strain
Phylum : Uncultured
Sequence :GTTGCGCTCGTTGTGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTCACAGATGCCTTGCGGCTTACGGCTTTCACCGTAATTCATCTGCAATTTAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAACGCTTTCGCTTGGCCGCTTGCTGTATATCGCAAACAGCGAGTATTCATCGTTTACCGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAGCCTCAATGTCAGTTGCAGCTTAGCAGGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACCACGAATTCCGCCTGCCTCAACTGCACTCAAGATATCCAGTATCAACTGCAATTTTACGGTTGAGCCGCAAACTTTCACAACTGACTTAAACATCCATCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGTGC

Unidentified_32

$400.00Price