Product Name : Unidentified_32

Species name : Uncultured organism clone ELU0025-T109-S-NIPCRAMgANa_000535/ Uncultured bacterium clone K503  (99.83%)

Species/Strain : Strain

Phylum : Uncultured organism clone ELU0025-T109-S-NIPCRAMgANa_000535_p

Sequence :GTTGCGCTCGTTGTGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTCACAGATGCCTTGCGGCTTACGGCTTTCACCGTAATTCATCTGCAATTTAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAACGCTTTCGCTTGGCCGCTTGCTGTATATCGCAAACAGCGAGTATTCATCGTTTACCGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAGCCTCAATGTCAGTTGCAGCTTAGCAGGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACCACGAATTCCGCCTGCCTCAACTGCACTCAAGATATCCAGTATCAACTGCAATTTTACGGTTGAGCCGCAAACTTTCACAACTGACTTAAACATCCATCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGTGC

Unidentified_32

$400.00Price