Product Name : Unidentified_31
Species name : Uncultured organism clone ELU0025-T109-S-NIPCRAMgANa_000535 (100%)Bacteroides vulgatus strain ADE11 (99.83%)
Species/Strain : Strain
Phylum : Uncultured
Sequence :TCGTTGTGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTCACAGATGCCTTGCGGCTTACGGCTTTCACCGTAATTCATCTGCAATTTAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAACGCTTTCGCTTGGCCGCTTGCTGTATATCGCAAACAGCGAGTATTCATCGTTTACCGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAGCCTCAATGTCAGTTGCAGCTTAGCAGGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACCACGAATTCCGCCTGCCTCAACTGCACTCAAGATATCCAGTATCAACTGCAATTTTACGGTTGAGCCGCAAACTTTCACAACTGACTTAAACATCCATCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGTGGC

Unidentified_31

$400.00Price