Product Name : Unidentified_30
Species name : Uncultured bacterium clone 16slp78-07f06.p1k/ Uncultured bacterium clone 16slp78-04h08.p1k(99.83%)
Species/Strain : Strain
Phylum : Uncultured
Sequence :CTGACGACACCATGCAGCACCTCGCAAACGGCTATTGCTAGAAAAGGTGTTTCCACCTCGGTCCGAATGCGTTCAAACCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGATCACTTAACGCTTTCGCTGTGCCGCTTACCGTGTATCGCAAACAGCTAGTGATCATCGTTTACTGCGTGGACTACCAGGGTATCTAATCCTGTTTGATCCCCACGCTTTCGTGCATCAGCGTCAGTCATGGCTTGGCAGGCTGCCTTCGCAATCGGGGTTCTGCGTGATATCTAAGCATTTCACCGCTACACCACGCATTCCGCCTGCCTCAAACATACTCAAGCCTCCCAGTTTCAACGGCAATTCTATGGTTGAGCCACAGACTTTCACCGCTGACTTAAAAGGCCGCCTACGCACCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGCTGACTGGC

Unidentified_30

$400.00Price