Product Name : Unidentified_6

Species name : (uncultured 12)Uncultured bacterium clone 2118007-1-25 /Uncultured bacterium clone 16slp5_04a06.p1k (99.83%)

Species/Strain : Species

Phylum : Uncultured bacterium clone 2118007-1-25_unclassified_P

Sequence :CGTTGTGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTCGCAAACGGCTATTGCTAGAAAAGGTGTTTCCACCTCGGTCCGAATGCGTTCAAACCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGATCACTTAACGCTTTCGCTGTGCCGCTTACAGTGTATCGCAAACAGCTAGTGATCATCGTTTACTGCGTGGACTACCAGGGTATCTAATCCTGTTTGATCCCCACGCTTTCGTGCATCAGCGTCAGTCATGGCTTGGCAGGCTGCCTTCGCAATCGGGGTTCTGCGTGATATCTAAGCATTTCACCGCTACACCACGCATTCCGCCTGCCTCAAACATACTCAAGCCTCCCAGTTTCAACGGCAATTCTATGGTTGAGCCACAGACTTTCACCGCTGACTTAAAAGGCCGCCTACGCACCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGG

Unidentified_6

$400.00Price