Product Name : JBV4-00106
Species name : Vibrio alginolyticus strain GS_MYPK1/Vibrio sp. strain GAMAL1 SWC(100%)
Species/Strain : Strain
Phylum : Proteobacteria
Sequence :CGGCGTCGAGCGGCGGACGGGTGAGTAATGCCTAGGAAATTGCCCTGATGTGGGGGATAACCATTGGAAACGATGGCTAATACCGCATGATGCCTACGGGCCAAAGAGGGGGACCTTCGGGCCTCTCGCGTCAGGATATGCCTAGGTGGGATTAGCTAGTTGGTGAGGTAAGGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGTCGTGAGGAAGGTAGTGTAGTTAATAGCTGCATTATTTGACGTTAGCGACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAATAGCATTTGAAACTGGCAGACTAGAGTACTGTAGAGGGGGGTAGAATTTCAGGTGTAGCGGTGAAATGCGTAGAGATCTGAAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAGATACTGACACTCAGATGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTTGGAGGTTGTGGCCTTGAGCCGTGGCTTTCGGAGCTAACGCGTTAAGTAGACCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAGAGAACTTTCCAG

JBV4-00106

$400.00Price