Product Name : JBB4-02203
Species name : Bacteroides thetaiotaomicron strain 8579/ Bacteroides thetaiotaomicron strain 8578(100%)
Species/Strain : Strain
Phylum : Bacteroidetes
Sequence :CGCTCGTTGTGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTCACATTTGCCTTGCGGCTAACCTGTTTCCAGATTATTCAAATGCAATTTAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAATGCTTTCGCTTGGCCGCTTACTGTATATCGCAAACAGCGAGTATTCATCGTTTACTGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAGCATCAGTGTCAGTTGCAGTCCAGTGAGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACCACGAATTCCGCCCACCTCTACTGTACTCAAGACAGCCAGTATCAACTGCAATTTTACGGTTGAGCCGCAAACTTTCACAACTGACTTAACTGTCCACCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGCGGG

JBB4-02203

$400.00Price