Product Name : JBT8-00101
Species name : Triticum aestivum cultivar Pamukova97 (99.69%)/Triticum aestivum voucher AT5 clone 1(99.54%)
Species/Strain : Species
Phylum : Embryophyta
Sequence :AACTCAGCGGGTAGTCCCGCCTGACCTGGGGTCGCGGTCGAAGCGACGTGCGCTTCGTTTGTTGGGTCGTTCAAGAGGCCATAATGCCAGGCTGCGCGCCGGATGCACTGCATTGATAAAGCGAGGACGCCCACCATGCGCTGTGTCCGGCGCGGTACGCCGGCAGCCCAATCTTCGGTCCACCGTCCCTTGAGAGACGAGGGACCAGATGCCGCATCCCGATTCCCGTTGAGGGTGGTTGGGAGCGTGTTTTGGCGTGACGCCCAGGCAGGCGTGCCCTCGGCCGAGTGGCCTCGGGCGCAACTTGCGTTCAAAGACTCGATGGTTCGCGGGATTCTGCAATTCACACCAGGTATCGCATTTCGCTACGTTCTTCATCGATGCGAGAGCCGAGATATCCGTTGCCGAGAGTCGTGTGGATTAAATAGCTTTGCAACACGAGGGACGGCTAGCAAGCTAGACATGCCCCCGGGTTAGGCACAGTGTTCCTTGACGCCTTCGGCGCCGTGGGTTCTTTTACCCCGAGCCCCCACCCGCTCCGAGGAGGGGAGGTGGTCGAGGCATTGGCCGAGCGACGGACGGTGCCGTCGCCGACGGATTGGATGACGCGTGCGCGGTCTGTTTTGGTCAGGGTCACGACAATGATCCTT

JBT8-00101

$400.00Price