Product Name : JBT4-00601
Species name : Cutaneotrichosporon jirovecii isolate E21549(100%)/Cutaneotrichosporon jirovecii isolate G10(99.77%)
Species/Strain : Species
Phylum : Basidiomycota
Sequence :CGCCAGATCGACAAGTTAAACACGCTAACTCTTTTAAGGCGAGCCAGGCAAGTGGCAGCGCCCAAATCCAAGCCATTAAGAAACCCTAATGGTTGAGATTTCATGATACTCAAACAGGCATGCTCTCCGGAATACCAGAGAGCGCAAGTTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCGAGAGCCAAGAGATCCGTTGTTGAAAGTTATTTTTGTTATAATAACATGACGTTCATTACACAATGTTTGTAAAGTAATTGACCGGAGTCAATCAACAGTTCACAGGTGTAGATGGATGTAGTTAACGCTCAAAGAGCAATTCACTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTACGACTTTTTACTTCCA

JBT4-00601

$400.00Price