Product Name : JBS13-03024
Species name : Staphylococcus gallinarum strain OOM34 /Staphylococcus haemolyticus strain SHKS1(99.44%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :TGCAAGTCGAGCGGTAACACAGAGGAGCTTGCTCCTTGGGTGACGAGCGGCGGACGGGTGAGTAATGCCTGGGGATCTGCCCGATAGAGGGGGATAACTACGGGAAACTGTAGCTAATACCGCATAATGTCTACGGACCAAAGTGGGGGCTCTTCGGACCTCATGCTATCGGATGAACCCAGGTGGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCTCTAACTGGTTTGAGAGAATGACCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGGGGAGGAAGGGTCACTAGTTAATACCTAGTGGCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGAGCTCAACTTGGGAACTGCATTTGAAACTGGCAAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGTCGATTTGGAGGTTGTGCCCTTGAGGCGTGGCTTCCGGAGCTAACGCGTTAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAGAGAACTTTCCAGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGT

JBS13-03024

$400.00Price