Product Name : JBS24-00303
Species name : Shewanella indica strain Sh15/Bacterium strain S4(99.89%)
Species/Strain : Strain
Phylum : Proteobacteria
Sequence :CATGCAAGTCGAGCGGTAACATTTCAAAAGCTTGCTTTTGAAGATGACGAGCGGCGGACGGGTGAGTAATGCCTGGGAATTTGCCCATTTGTGGGGGATAACAGTTGGAAACGACTGCTAATACCGCATACGCCCTACGGGGGAAAGCAGGGGAACTTCGGGCCTTGCGCTGATGGATAAGCCCAGGTGGGATTAGCTAGTAGGTGAGGTAATGGCTCACCTAGGCAACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAAGGGTGTAAGTTAATACCTTACATCTGTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTGTTAAGCGAGATGTGAAAGCCCCGGGCTCAACCTGGGAACCGCATTTCGAACTGGCAAACTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTCGGAGTTTGGTGTCTTGAACACTGGGCTCTCAAGCTAACGCATTAAGTAGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTTGACGG

JBS24-00303

$400.00Price