Product Name : JBS15-04003
Species name : Streptococcus oralis subsp. tigurinus strain 835/Streptococcus sp. BS29a(99.62%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :ACCATGCAGTCGAGCGGAAACGAGTTATCTGAACCTTCGGGGAACGATAACGGCGTCGAGCGGCGGACGGGTGAGTAATGCCTAGGAAATTGCCCTGATGTGGGGGATAACCATTGGAAACGATGGCTAATACCGCATGATGCCTACGGGCCAAAGAGGGGGACCTTCGGGCCTCTCGCGTCAGGATATGCCTAGGTGGGATTAGCTAGTTGGTGAGGTAAGGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGTCGTGAGGAAGGTGGTGTTGTTAATAGCTGTATCATTTGACGTTAGCGACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAATAGCATTTGAAACTGGCAGACTAGAGTACTGTAGAGGGGGGTAGAATTTCAGGTGTAGCGGTGAAATGCGTAGAGATCTGAAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAGATACTGACACTCAGATGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTTGGAGGTTGTGGCCTTGAGCCGTGGCTTTCGGAGCTAACGCGTTAAGTAGACCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAGAGAACTTTCCAGAGATGGATTGGTGCCTTCGG

JBS15-04003

$400.00Price