Product Name : JBS13-03012
Species name : Staphylococcus gallinarum strain AB328/Staphylococcus arlettae strain NR_036903.1(99.63%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :GGATGAGTGGAGCTTGCTCCATGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGTGGGGGATCTTCGGACCTCGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCGAGCTAGAGTATGGCAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGGCTAATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTAGCCGTTGGGATCCTTGAGATCTTAGTGGCGCAGCTAACGCATTAAGTCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAAC

JBS13-03012

$400.00Price