Product Name : JBS13-03003
Species name : Staphylococcus gallinarum strain AB328 /Staphylococcus arlettae strain NR_036903.1(99.79%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :CCTAACACATGCAAGTCGAGCGGAACGAGTTATCTGAACCTTCGGGGAACGATAACGGCGTCGAGCGGCGGACGGGTGAGTAATGCCTAGGAAATTGCCCTGATGTGGGGGATAACCATTGGAAACGATGGCTAATACCGCATGATGCCTACGGGCCAAAGAGGGGGACCTTCGGGCCTCTCGCGTCAGGATATGCCTAGGTGGGATTAGCTAGTTGGTGAGGTAAGGGCTCACCAAGGCGACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGTCGTGAGGAAGGTGGTGTCGTTAATAGCGGCATTGTTTGACGTTAGCGACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAATAGCATTTGAAACTGGCAGACTAGAGTACTGTAGAGGGGGGTAGAATTTCAGGTGTAGCGGTGAAATGCGTAGAGATCTGAAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAGATACTGACACTCAGATGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTTGGAGGTTGTGGCCTTGAGCCGTGGCTTTCGGAGCTAACGCGTTAAGTAGACCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAGAGAACTTTCCAGAGATGGATTGGTGCCTTTCGGGAACTCTGAGACA

JBS13-03003

$400.00Price