Product Name : JBE8-00125
Species name : Escherichia coli strain SA10/Escherichia coli strain N12-3(100%)
Species/Strain : Strain
Phylum : Proteobacteria
Sequence :ACAGCCATGCAGCACCTGTCTCACAGTTCCCGAAGGCACCAATCCATCTCTGAAAAGTTCTGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCA

JBE8-00125

$400.00Price