Product Name : JBK1-00110
Species name : Klebsiella pneumoniae strain CPST2/Klebsiella pneumoniae strain HCD1-6 (99.79%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :GACTTAACCCAACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCACTTTGTCCCCCGAAGGGGAAGGCTCTATCTCTAGAGTTGTCAAAGGATGTCAAGATTTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGTCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGCGTTAGCTGCAGCACTAAGGGGCGGAAACCCCCTAACACTTAGCACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGATCCCCACGCTTTCGCACATCAGCGTCAGTTACAGACCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCATATCTCTGCGCATTTCACCGCTACACATGGAATTCCACTTTCCTCTTCTGCACTCAAGTTTTCCAGTTTCCAATGACCCTCCACGGTTGAGCCGTGGGCTTTCACATCAGACTTAAAAAACCGCCTACGCGCGCTTTACGCCCAATAATTCCGGATAACGCTTGCCACCTACGTAT

JBK1-00110

$400.00Price