Product Name : JBS13-00105
Species name : Staphylococcus aureus strain ATCC 12600/Staphylococcus aureus strain S33 R (100%)
Species/Strain : Strain
Phylum : Firmicutes
Sequence :GACTTAACCCAACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCACTTTGTCCCCCGAAGGGGAAGGCTCTATCTCTAGAGTTGTCAAAGGATGTCAAGATTTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGTCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGCGTTAGCTGCAGCACTAAGGGGCGGAAACCCCCTAACACTTAGCACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGATCCCCACGCTTTCGCACATCAGCGTCAGTTACAGACCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCATATCTCTGCGCATTTCACCGCTACACATGGAATTCCACTTTCCTCTTCTGCACTCAAGTTTTCCAGTTTCCAATGACCCTCCACGGTTGAGCCGTGGGCTTTCACATCAGACTTAAAAAACCGCCTACGCGCGCTTTACGCCCAATAATTCCGGATAACGCTTGCCACCTACGTAT

JBS13-00105

$400.00Price