Product Name : JBP7-00101
Species name : Penicillium chrysogenum isolate ENDO-PINE700-BOTTOMB/Penicillium chrysogenum isolate 1RC3(100%)
Species/Strain : Species
Phylum : Ascomycota
Sequence :TTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGATAAAAATTTGGGTTGATCGGCAAGCGCCGGCCGGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGATCGGAGGACGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAAATAATTTATATTTTCACTCAGACTACAATCTTCAGACAGAGTTCGAGGGTGTCTTCGGCGGGCGCGGGCCCGGGGGCGTAAGCCCCCCGGCGGCCAGTTAAGGCGGGCCCGCCGAAGCAACAAGGTAAAATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAA

JBP7-00101

$400.00Price