Product Name : JBP16-00820
Species name : Pseudomonas stutzeri strain AZ101(99.90%)/Pseudomonas stutzeri strain NRC3-8PS(99.69%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :CATGCAAGTCGAGCGGTAACATTTCAAAAGCTTGCTTTTGAAGATGACGAGCGGCGGACGGGTGAGTAATGCCTGGGAATTTGCCCATTTGTGGGGGATAACAGTTGGAAACGACTGCTAATACCGCATACGCCCTACGGGGGAAAGCAGGGGAACTTCGGGCCTTGCGCTGATGGATAAGCCCAGGTGGGATTAGCTAGTAGGTGAGGTAATGGCTCACCTAGGCAACGATCCCTAGCTGGTCTGAGAGGATGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAAGGGTGTAAGTTAATACCTTACATCTGTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTGTTAAGCGAGATGTGAAAGCCCCGGGCTCAACCTGGGAACCGCATTTCGAACTGGCAAACTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTCGGAGTTTGGTGTCTTGAACACTGGGCTCTCAAGCTAACGCATTAAGTAGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTTGACGG

JBP16-00820

$400.00Price