Product Name : JBP23-00107
Species name : Photobacterium damselae strain TV27/Photobacterium damselae strain TV25 (99.88%)
Species/Strain : Strain
Phylum : Proteobacteria
Sequence :TTTACCGTGGCATTCTGATCCACGATTACTAGCGATTCCGACTTCACGGAGTCGAGTTGCAGACTCCGATCCGGACTACGACATACTTTCTGGGATTCGCTCCACCTCGCGGTCTTGCTGCCCTCTGTATATGCCATTGTAGCACGTGTGTAGCCCTACTCGTAAGGGCCATGATGACTTGACGTCGTCCCCACCTTCCTCCGGTTTATCACCGGCAGTCTCCCTGGAGTTCCCACCCGAAGTGCTGGCAAACAAGGATAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCAGCACCTGTCTCAGAGTTCCCGAAGGCACACTCGAATCTCTTCAAGCTTCTCTGGATGTCAAGAGTAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAATCTTGCGACCGTACTCCCCAGGCGGTCTACTTAACGCGTTAGCTCCGAAAGCCACGGCTCAAGGCCACAACCTCCAAGTAGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCATCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCGCCACTGGTATTCCTTCAGATCTCTACGCATTTCACCGCTACACCTGAAATTCTACCCCCCTCTACAAGACTCTAGCCTGCCAGTTTCAAATGCAATTCCGAGGTTAAGCCCCGGGCTTTCACATCTGACTTTACAGGCCGCCTGCATGCGCTTTACGCCCAGTA

JBP23-00107

$400.00Price