Product Name : JBP23-00103
Species name : Photobacterium damselae strain TV27/Photobacterium damselae strain TV25 (100%)
Species/Strain : Strain
Phylum : Proteobacteria
Sequence :GTGTACAAGGCCCGGGAACGTATTCACCGTGGCATTCTGATCCACGATTACTAGCGATTCCGACTTCACGGAGTCGAGTTGCAGACTCCGATCCGGACTACGACATACTTTCTGGGATTCGCTCCACCTCGCGGTCTTGCTGCCCTCTGTATATGCCATTGTAGCACGTGTGTAGCCCTACTCGTAAGGGCCATGATGACTTGACGTCGTCCCCACCTTCCTCCGGTTTATCACCGGCAGTCTCCCTGGAGTTCCCACCCGAAGTGCTGGCAAACAAGGATAAGGGTTGCGCTCGTTGCGGGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCAGCACCTGTCTCAGAGTTCCCGAAGGCACACTCGAATCTCTTCAAGCTTCTCTGGATGTCAAGAGTAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAATCTTGCGACCGTACTCCCCAGGCGGTCTACTTAACGCGTTAGCTCCGAAAGCCACGGCTCAAGGCCACAACCTCCAAGTAGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCATCTGAGCGTCAGTCTTTGTCCAGGGGGCCGCCTTCGCCACTGGTATTCCTTCAGATCTCTACGCATTTCACCGCTACACCTGAAATTCTACCCCCCTCTACAAGACTCTAGCCTGCCAGTTTCAAATGCAATTCCGAGGTTAAGCCCCGGGCTTTCACATCTGACTTAACAGGCCGCCTGCATGCGCTTTACGCCCAGTAATTCCGATTAACGCTCG

JBP23-00103

$400.00Price