Product Name : JBP22-00108
Species name : Plesiomonas shigelloides strain 190718 /Plesiomonas shigelloides strain FDAARGOS_725(100%)
Species/Strain : Strain
Phylum : Proteobacteria
Sequence :TGCAAGTCGAGCGGTAACACAGAGGAGCTTGCTCCTTGGGTGACGAGCGGCGGACGGGTGAGTAATGCCTGGGGATCTGCCCGATAGAGGGGGATAACTACGGGAAACTGTAGCTAATACCGCATAATGTCTACGGACCAAAGTGGGGGCTCTTCGGACCTCATGCTATCGGATGAACCCAGGTGGGATTAGCTAGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCTCTAACTGGTTTGAGAGAATGACCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGGGGAGGAAGGGTCACTAGTTAATACCTAGTGGCATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGAGCTCAACTTGGGAACTGCATTTGAAACTGGCAAGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGTCGATTTGGAGGTTGTGCCCTTGAGGCGTGGCTTCCGGAGCTAACGCGTTAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAGAGAACTTTCCAGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGT

JBP22-00108

$400.00Price