Product Name : JBP19-00301
Species name : Pantoea sp. strain ICMP 20864/Pantoea agglomerans strain S2 (99.89%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :TGACGACAGCCATGCAGCACCTGTCTCAGCGTTCCCGAAGGCACCAAGGCATCTCTGCCAAGTTCGCTGGATGTCAAGAGTAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACTCCTCAAGGGAACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACAAGACTCAAGCCTGCCAGTTTCAAATGCAGTTCCCAGGTTAAGCCCGGGGATTTCACATCTGACTTAACAGACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATCGACGCGGTTATTAACCACATCGCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGGGCCATTACCCCGCCTACTAGCTAATCCCATCTGGGTTCATCCGATAGTGAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGAC

JBP19-00301

$400.00Price