Product Name : JBP12-01901
Species name : Prevotella oralis ATCC 33269 strain JCM 12251/Prevotella oralis ATCC 33269(99.66%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :GCGGGGCATCATGGAAGGTTGTTTTCAACTTTTGATGGCGACCGGCGCACGGGTGAGTAACGCGTATCCAACCTTCCCATTACTACGGCATACCCCGTTGAAAGGCGGCCTAATTCCGTATGCAGTCCGAAGCAGTCATCTAATTTGGACGAAAGGTATATTCTATCGGTAATGGATGGGGATGCGTCCGATTAGCCAGCCGGCGGGGTAACGGCCCACCGGGGCATCGATCGGTAGGGGTTCTGAGAGGAAGGTCCCCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGGCGTAAGCCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATGCGGGGATAAAGTTGGGGACGTGTCCCTTTTTGCAGGTACCGCATGAATAAGGACCGGCTAATTCCGTGCCAGCAGCCGCGGTAATACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCAGTTTTTTAAGCGTGCTGTGAAATGTACCGGCTCAACCGGTGATGTGCAGCGCGAACTGGGAATCTTGAGTACGCAGTAAGCAGGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAAGAACTCCGATTGCGTAGGCAGCTTGCTGTAGCGTAACTGACGCTGAAGCTCGAAAGTGCGGGTATCGAACAGGATTAGATACCCTGGTAGTCCGCACGGTAAACGATGGATGCCCGCTGTCGGCCTTTTTTGGTCGGTGGCCAAGCGAAAGCGTTAAGCATCCCACCTGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAAATTGACGGGGGGCCCGCACAAGCGGAAG

JBP12-01901

$400.00Price