Product Name : JBP12-01801
Species name : Prevotella nigrescens strain KCOM 3365 (=ChDC P010-1) /Prevotella nigrescens strain KCOM 3250 (=JS356) (100%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :CTGGCTACAGGCTTAACACATGCAAGTCGTGGGGAAACGGCATTATGTGCTTGCACATTCTGGACGTCGACCGGCGCACGGGTGAGTATCGCGTATCCAACCTGCCCCTTACTTGGGGATACCCCGTTGAAAGACGGCCTAATACCCGATGTGTTTCATTGACGGCATCCGATATGAAACAAAGGTTTTCCGGTAAGGGATGGGGATGCGTCTGATTAGCTTGTTGGCGGGGCAACGGCCCACCAAGGCGACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACATTGGAACTGAGACACGGTCCAAACTCCTACGGGAGGCAGCAGTGAGGAATATTGGTCAATGGACGCAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATGTGGGAATAAAGTGGCGCACGTGTGCGCCATTGCATGTACCTCATGAATAAGGACCGGCTAATTCCGTGCCAGCAGCCGCGGTAATACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGTGTAGGCGGTCTGTTAAGCGTGTTGTGAAATTTAGGTGCTCAACATTTAACTTGCAGCGCGAACTGTCAGACTTGAGTACACGCAGCGCAGGCGGAATTCATGGTGTAGCGGTGAAATGCTTAGATATCATGAGG

JBP12-01801

$400.00Price