Product Name : JBP12-01201
Species name : Prevotella loescheii strain JCM 8530/Prevotella loescheii strain JCM 12249 (99.46%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :TACCGGATTTATTGGGTTTAAGGGAGCGTAGGCCGCGCCTTAAGCGTGTTGTGAAATCCGGGTGCTCAACATCCGGCTTGCAGCGCGAACTGGGGCGCTTGAGTGCGCTGAAAGTAGGCGGAATTCGTGGTGTAGCGGTGAAATGCTTAGATATCACGAGGAACTCCGATTGCGAAGGCAGCCTACTGTAGCGCTACTGACGCTGATGCTCGAAAGCGTGGGTATCGAACAGGATTAGATACCCTGGTAGTCCACGCGGTAAACGATGGATGCTCGTTGTCGGCCCCTTGGGTCGGTGACCAAGCGAAAGCGTTAAGCATCCCACCTGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTGAACTGCGGCGGAACGATTCGGAGACGATGAGGCCCTTCGGGGCCGCCGCGGAGGTGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGCTTAAGTGCCACAACGAGGGCAACCCAGA

JBP12-01201

$400.00Price