Product Name : JBP12-01101
Species name : Prevotella intermedia strain KCOM 3297 (=JS360)/Prevotella intermedia strain KCOM 3234 (JS341) (99.62%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :TAGGCGGTCTGTTAAGCGTGTTGTGAAATTTAGGTGCTCAACATNTACCTTGCAGCGCGAACTGGCGGACTTGAGTGCACGCAACGTATGCGGAATTCATGGTGTAGCGGTGAAATGCTTAGATATCATGACGAACTCCGATTGCGAAGGCAGCGTACGGGAGTGTTACTGACGCTTAAGCTCGAAGGTGCGGGTATCGAACAGGATTAGATACCCTGGTAGTCCGCACGGTAAACGATGGATGCCCGCTGTTAGCGCCTGGCGTTAGCGGCTAAGCGAAAGCATTAAGCATCCCACCTGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTGAATTGCAGACGCAGGATACAGAGATGTTGACTCCCTTCGGGGCGTCTGTGAAGGTGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGCTTAAGTGCCATAACGAGCCGCAACCCA

JBP12-01101

$400.00Price