Product Name : JBP12-00701
Species name : Prevotella denticola
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :CCCGAAGGACCTCAAGCATCTCTGTTTCGTTCTCCTGCAATTCAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGGATGCTTAACGCTTTCGCTTGGCCCCCGGCGCCATGCGCCGACAGCGGGCATCCATCGTTTACCGTGCGGACTACCAGGGTATCTAATCCTGTTCGATACCCGCACCTTCGAGCTTCAGCGTCAGTTGCGCTCCCGCCGGCTGCCTTCGCAATCGGGGTTCTTCGTCATATCTAAGCATTTCACCGCTACACGACGAATTCCGCCGGCGTTGCGCGTACTCAAGGGAACCAGTATGCGCTGCAAGTCAGACGTTGGGCGCCTACATTTCACAACACACTTAATCCCCGGCCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCCCGGACCTTCCGTATTACCGCGGCTGCTGGCACGGAATTAGCCGGTCCTTATTCATGCGGTACCTGCAAAAAGGGACACGTCCCTCACTTTATCCCCGCATAAAAGCAGTTTACAACCCGTAGGGCCGTCCTCCTGCACGCTACTTGGCTGGTTCAGGCTTCCGCCCATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTACTGATCGTCGCCTTGGTGGGCCGTCGCCCCGCCAACAAGCTAATCAGA

JBP12-00701

$400.00Price