Product Name : JBP12-00501
Species name : Prevotella copri strain Y7XP/Uncultured bacterium clone BNO_aaa03a12(99.63%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :AGCTGACGACACCATGCAGCACCTTCACAGAGACCCCGAAGGGCGTCATTGTCTCCAAATCCTTCCTCTGCAATTCAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGGATGCTTAATGCTTTCGCTTGGCCGCTGACCTATTCAGACCAACAGCGGGCATCCATCGTTTACCGTGCGGACTACCAGGGTATCTAATCCTGTTCGATACCCGCACTTTCGAGCTTCAGCGTCAGTTGCGCTCCAGTGAGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACCACGAATTCCGCCCACTTTGTGCGTACTCAAGGAAACCAGTTCGCGCTGCAGTGCAGATGTTGAGCATCTACATTTCACAACACGCTTAATCTCCGGCCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCCCGGACCTTCCGTATTACCGCGGCTGCTGGCACGGAATTAGCCGGTCCTTATTCATAAGGTACATGCAAAAAGTCTCACGAGACTCACTTTATTCCCTTATAAAAGCAGTTTACAACCCATAGGGCCGTCATCCTGCACGCTACTTGGCTGGTTCAGACTCTCGTCCATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCATGTGGGGGACCTTCCTCTCAGAACCCCTACTGATCGTCGCCTTGGTGGGCCGTTACCCCGCC

JBP12-00501

$400.00Price