Product Name : JBP12-00301
Species name : Prevotella bergensis strain JCM 13869/Uncultured bacterium clone nbw778f12c1(99.10%)
Species/Strain : Species
Phylum : Bacteroidetes
Sequence :CGGATTTATTGGGTTTAAGGGAGCGTAGGCCGTGGGTTAAGTGTGTTGTGAAATCCGGTTGCTCAACATCCGGTTTGCAGCGCATACTGTCTCACTTGAGTGCGCACAACGCAGGCGGAATTCGTCGTGTAGCGGTGAAATGCTTAGATATGACGAGGAACCCCGATTGCGAAGGCAGCTTGCGGGAGCGCAACTGACGCTTAAGCTCGAAGGTGCGGGTATCAAACAGGATTAGATACCCTGGTAGTCCGCACGGTAAACGATGGATGCCCGCTGTTTGCCCTATTTTGGGCATGCGGCCAAGCGAAAGCATTAAGCATCCCACCTGGGGAGTACGCCGGCAACGGTGAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGAGGAACATGTGGTTTAATTCGATGATACGCGAGGAACCTTACCCGGGCTTGAACTGCCAGTGAACGATACAGAGATGTTGAGGCCCTTCGGGGCGCTGGTGGAGGTGCTGCATGGTTGTCGTCAGCTCGTGCCGTGAGGTGTCGGCTTAAGTGCCACAACGGGCCCACCCCTATAA

JBP12-00301

$400.00Price