Product Name : JBP1-00701
Species name : Paenibacillus dendritiformis strain ClaCZ203/Paenibacillus sp. strain 3179 (99.82%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :CCAACATCTCACGACACGAGTTGACGACAACCATGCACCACCTGTCACCTCTGCCCCGAAGGGAAGCCCTATCTCTAGGACGGTCAGAGGGATGTCAAGACCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATACTCCACTGCTTGTGCGGGTCCCCGTCAATTCCTTTGAGTTTCAGTCTTGCGACCGTACTCCCCAGGCGGAATGCTTAATGTGTTAACTTCGGCACCAAGGGTATCGAAACCCCTAACACCTAGCATTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCGCCTCAGCGTCAGTTACAGCCCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCACATCTCTACGCATTTCACCGCTACACGTGGAATTCCACTTTCCTCTTCTGCACTCAAGTCACACAGTTTCCGATGCGACCCGGAGTTGAGCCCCGGGTTTAAACACCAGACTTACATGACCGCCTGCGCGCGCTTTACGCCCAATAATTCCGGACAACGCTTGCCC

JBP1-00701

$400.00Price