Product Name : JBP16-00801
Species name : Pseudomonas stutzeri strain CUMB KMR - 05/Pseudomonas stutzeri strain 0159(100%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :GTGTGATCCATAATTATCCCCCTATCTCTAAGGGTATTTGTTTCCATGTCAAGGCCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATACTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACACTTGCGTGCATACTCCCCAGGCGGAGAACTTATTGCGTTAACTGCAGCACTGAATTCCTCCAACACTTAGTTCTCATCGTTTACGGCGTGGACTACTAGGGTATCTAATCCTATTTGCTCCCCACGCTTTCGTGCCTCAGTGTCAGTTACAGACCAGGCGACCGCCTTCGCCACTGGTGTTCCTCCATATATCTACGCATTTTACCGCTACACATGGAATTCCATCGCCCTCTTCTGCACTCCAGCATACCAGTTTCCATAGCTTACAATGGTTGAGCCATTGCCTTTTACTACAGACTTAGTACGCCACCTACGCACCCTTTACGCCCAATGATTCCGGATAACGCTTGCCACCTACGTATTAC

JBP16-00801

$400.00Price