Product Name : JBL5-00801
Species name : Leuconostoc mesenteroides subsp. dextranicum strain M-25/Leuconostoc mesenteroides strain 4622(100%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :CATGCACCACCTGTCACTTTGTCTCCGAAGAGAACACTTCTATCTCTAAAAGCTTCAAAGGATGTCAAGACCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGTCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAACACTTAATGCGTTAGCTTCGGCACTAAGAGGCGGAAACCTCCTAACACCTAGTGTTCATCGTTTACGGTGTGGACTACCAGGGTATCTAATCCTGTTTGCTACCCACACTTTCGAGCCTCAACGTCAGTTGCAGTCCAGTAAGCCGCCTTCGCCACTGGTGTTCTTCCATATATCTACGCATTCCACCGCTACACATGGAGTTCCACTTACCTCTACTGCACTCAAGTTAACCAGTTTCCAATGCCATTCCGGAGTTGAGCTCCGGGCTTTCACATCAGACTTAATAAACCGTCTGCGCTCGCTTTACGCCCAATAAATCCGGATAACGCTCGGGACATACGTATTACCGCGGCTGCTGGCACGTATTTAGCCGTCCCTTTCTGGTATGGTACCGTCAAACTAAAATCATTTCCTATTCTAGCTGTTCTTCCCATACAACAGTGCTTTACGACCCGAAAGCCTTCATCACACACGCGGCGTTGCTCCATCAGGCTTTCGCCCATTGTGGAAGATTCCCTACTGCAGCCTCCCGTAGGAGTTTGGGCCGTGTCTCAGTCCCAATGTGGCCGATCAGTCTCTCAACTCGGCTATGCATCATTGTCTTGGTAGGCCTTTACCCCACCAACTAACTAATGCACCGCGGATCCATCTCTAGGTGACGCCGAAGCGCCTTTTAACTTTGTGTCATGCGACACTAAGTTTTATTCGGTATTAGCATCTGTTTCCAAATGTTATCCCCAGCCTTGAGGCAGGTTGTCCACGTGTTACTCACCCGTTCGCCACTCACTTGAAAGGTGCAA

JBL5-00801

$400.00Price