Product Name : Unidentifed_7
Species name : Uncultured_13(Uncultured organism clone ELU0111-T274-S-NI_000172/Uncultured organism clone ELU0111-T274-S-NI_000171(100%))
Species/Strain : Species
Phylum : Uncultured
Sequence :TGCAGCACCTTCACATTTGCCTTGCGGCTAACCTGTTTCCAGATTATTCAAATGCAATTTAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAATGCTTTCGCTTGGCCGCTTACTGTATATCGCAAACAGCGAGTATTCATCGTTTACTGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAGCATCAGTGTCAGTTGCAGTCTAGTGAGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACCACGAATTCCGCCCACCTCTACTGTACTCAAGACTGCCAGTTTCAACTGCAATTTTACGGTTGAGCCGCAAACTTTCACAACTGACTTAACAATCCACCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGATCCTTATTCATATGGTACATACAAAATCCCACACGTGGAATACTTTATTCCCATATAAAAGAAGTTTACAACCCATAGGGCAGTCATCCTTCACGCTACTTGGCTGGTTCAGACTCTCGTCCATTGACCAATATTCCTCACTGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTATCCATCGTTGTCTTGGTGGGCCGTTACCCCGCCAACAAACTAATGGAACGCA

Unidentifed_7

$400.00Price