Product Name : Unidentifed_6
Species name : (uncultured 12)Uncultured bacterium clone 2118007-1-25 /Uncultured bacterium clone 16slp5_04a06.p1k (99.83%)
Species/Strain : Species
Phylum : Uncultured
Sequence :CGTTGTGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTCGCAAACGGCTATTGCTAGAAAAGGTGTTTCCACCTCGGTCCGAATGCGTTCAAACCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGATCACTTAACGCTTTCGCTGTGCCGCTTACAGTGTATCGCAAACAGCTAGTGATCATCGTTTACTGCGTGGACTACCAGGGTATCTAATCCTGTTTGATCCCCACGCTTTCGTGCATCAGCGTCAGTCATGGCTTGGCAGGCTGCCTTCGCAATCGGGGTTCTGCGTGATATCTAAGCATTTCACCGCTACACCACGCATTCCGCCTGCCTCAAACATACTCAAGCCTCCCAGTTTCAACGGCAATTCTATGGTTGAGCCACAGACTTTCACCGCTGACTTAAAAGGCCGCCTACGCACCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGG

Unidentifed_6

$400.00Price