Product Name : JBE6-00523
Species name : Enterococcus faecalis strain IGM6-4 /Enterococcus faecalis strain IAH_17(99.79%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :ACCATGCACCACCTGTCACCGGTGTGCCGAAGCAAAATCCTATCTCTAGGACGGGCACCGGGATGTCAAGACCTGGTAAGGTTCTTCGCGTTGCTTCAAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGCGTTAGCTGCGGCACTGAGTCCCGGAAAGGACCCAACACCTAGCACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAGCGTCAGTTACAGACCAAAGAGCCGCTTTCGCCACCGGTGTTCCTCCATATATCTACGCATTTCACCGCTACACATGGAATTCCACTCTCCCCTTCTGCACTCAAGTTAAACAGTTTCCAAAGCGTACTATGGTTAAGCCACAGCCTTTAACTTCAGACTTATCTAACCGCCTGCGCTCGCTTTACGCCCAATAAATCCGGACAACGCTCGGGACCTACGTATTACCGCGGCTGCTGGCACGTAATTAGCCGTCCCTTTCTGGTAAGATACCGTCACAGTGTGAACTTTCCACTCTCACACTCGTTCTTCTCTTACAACAGAGCTTTACGATCCGAAAACCTTCTTCACTCACGCGGCGTTGCTCGGTCAGACTTCCGTCCATTGCCGAAGATTCCCTACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCACTCCCAGTGTGGCCGATCACCCTCTCAGGTCGGCTATGTATCGTCGCCTTGGTGAGCC

JBE6-00523

$400.00Price