Product Name : JBE9-00401
Species name : [Eubacterium] eligens ATCC 27750/Uncultured bacterium clone SJTU_C_09_21(99%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :GCATATGATGCGGGTCGAACGATTCATTTGGAGCAGATTATTTCGGTATGAAGTTCTTTATGACTGAGTGGCGGACGGGTGAGTAACGCGTGGGTAACCTGCCTTGTACTGGGGGATAGCAGCTGGAAACGGCTGGTAATACCGCATAAGCGCACAATGTTGCATGACATGGTGTGAAAAACTCCGGTGGTATAAGATGGACCCGCGTCTGATTAGCTAGTTGGTGAGATAACAGCCCACCACAGGCGACGATCAGTAGCCGACCTGAGAGGGTGACCGGCCACATTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGAGGAAACTCTGATGCAGCGACGCCGCGTGAGGTGAAGAAGTAATTCGTTATGTAAAGCTTCTATCAGCAGGGAAGATAGTGACGGTACCTGACTAAGAAGCTCCGGCTAAATACGTGCCAGCAGCCGCGGTAATACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCCATGCAAGTCAGAAGTGAAAATCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTAAGGCTGGAGTGCAGGAGGGGTGAGTGGAATTCCTAGTGTAGCGGTGAAATGCGTAGATATTAGGAGGAACACCAGTGGCGAAGGCGGCTCACTGGACTGTAACTGACACTGAGGCTCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAATACTAGGTGTCGGGGCCCATAAGGGCTTCGGTGCCGCAGCAAACGCAATAAGTATTCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATTGACGGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAAGTCTTGACATCCCCACTGACCGGACAGTAATGTGTCCTTTCCTTCGGGACAGTGAGAGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGAATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCCTATCCTTAGTAGCCAGCAGTAAGATGGGCACTCTAGGGAGACTGCCAGGGATAACCTGGAGGAAGGTGGGGATGACGTCAAATCATCATGCCCCTTATGACTTGGGCTACACACGTGCTACAATGGCGTAAACAAAGTGAAGCGAAGTCGTGAGGCCAAGCAAATCACAAAAATAACGTCTCAGTTCGGATTGTAGTCTGCAACTCGACTACATGAAGCTGGAATCGCTAGTAATCGCAGATCAGAATGCTGCGGTGAATACGTTCCCGGGTCTTGTACACACCGCCCGTCACACCATGGGAGTCGAAAATGCCCGAAGTCGGTGACCTAACGCAAGAAGGA

JBE9-00401

$400.00Price