Product Name : JBE8-00401
Species name : Escherichia sp. ESBL163B1_13_2E/Escherichia sp. 900B6_12EESBL(99.65%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :GCGTCGTTGCGGGACTTAACCCAACATTTCACAACAGGAGCTGACGACAGCCATGCAGCACCTGTCTCACGGTTCCCGAAGGCACATTCTCATCTCTGAAAACTTCCGTGGATGTCAAGACCAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGCGGCCGTACTCCCCAGGCGGTCGACTTAACGCGTTAGCTCCGGAAGCCACGCCTCAAGGGCACAACCTCCAAGTCGACATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACCTGAGCGTCAGTCTTCGTCCAGGGGGCCGCCTTCGCCACCGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTAT

JBE8-00401

$400.00Price