Product Name : JBE7-00101
Species name : Epidermophyton floccosum strain 600013/20/Epidermophyton floccosum strain 600211/19(99.21%)
Species/Strain : Species
Phylum : Ascomycota
Sequence :CATCTGGGTACCCTACCTGATCCGAGGTCCACCTGAATGCGGAGGGGAAGAAGAAGGGGTCCGCCCCCTTTCGTCCTCCCGACGGAAACTAGGGCCAGAGAGCCGGCCGGTCCTGAAGGCGCTGGTTTTGTTGCCCATTCGCCCAGGGGCCCGGAATCGCGGCCTGGCCACTGCTTTTCGGGCGCGTCCCCTCCACCTTTCTCCTCTCCCGGTGGAACGGGGGATGCAAAGGCGGTCGGACGGTCGTCCATCACACAAGCCGGGCTTGAGGGGTTGAAATGACGCTCGAACAGGCATGCCCCCCGGAATACCAGAGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACGGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTGACTGGTTTTTGCTTGCCAACGCTCAGACTGAACCACCTATGGAGATTTCGTAGAATTTCTGAGAATCACTCCTTCGGCGAGCGCTGTCCAGGGGTGGGGGAGCGATCAACCCCGCCGGGGCATCCTTCTCCATCCCCCGAACGGCCCCCCCGAGACGCTGCAGCGACACTGCAGCCTAGGGGGCGCGGCCCGCCGAGGCAACCGGGTAGTGTAGACAAGAATGGGCGTGTGGCCGGCGACACCGTCCAGCATTCAGAGAGAAGGGGGACGGGCCGACTGCGGCCTGCGCGTTAATGATCCTTCCGCAGGTTCACCTACGGAAACCTTGTTTTATTTTTTTTTTACTATACA

JBE7-00101

$400.00Price