Product Name : JBL3-00106
Species name : Lactococcus garvieae strain CNM147_12/Lactococcus garvieae strain 2542(100%)
Species/Strain : Strain
Phylum : Firmicutes
Sequence :ACGGACCGGAGCTGACGACACCATGCACCACCTGTATCCCGTGTCCCGAAGGAACTCCTTATCTCTAAGGATAGCACGAGTATGTCAAGACCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGCGTTAGCTGCGCTACAGAGAACTTATAGCTCCCTACAGCTAGCACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAGTGTCAGTTACAGGCCAGAGAGCCGCTTTCGCCTCCGGTGTTCCTCCATATATCTACGCATTTCACCGCTACACATGGAATTCCACTCTCCTCTCCTGCACTCAAGTCTCCCAGTTTCCAATGCACACAATGGTTGAGCCACTGCCTTTTACATCAGACTTAAGAAACCACCTGCGCTCGCTTTACGCCCAATAAATCCGGACAACGCTTGGGACCTACGTATTACCGCG

JBL3-00106

$400.00Price