Product Name : JBE6-00913
Species name : Enterococcus hirae strain 1677/Enterococcus hirae strain 1425 (99.40%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :GACTTAACCCAACATCTCACGACACGAGCTGACGACAACCATGCACCACCTGTCACTTTGTCCCCCGAAGGGGAAGGCTCTATCTCTAGAGTTGTCAAAGGATGTCAAGATTTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGTCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTCCCCAGGCGGAGTGCTTAATGCGTTAGCTGCAGCACTAAGGGGCGGAAACCCCCTAACACTTAGCACTCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGATCCCCACGCTTTCGCACATCAGCGTCAGTTACAGACCAGAAAGTCGCCTTCGCCACTGGTGTTCCTCCATATCTCTGCGCATTTCACCGCTACACATGGAATTCCACTTTCCTCTTCTGCACTCAAGTTTTCCAGTTTCCAATGACCCTCCACGGTTGAGCCGTGGGCTTTCACATCAGACTTAAAAAACCGCCTACGCGCGCTTTACGCCCAATAATTCCGGATAACGCTTGCCACCTACGTAT

JBE6-00913

$400.00Price