Product Name : JBE8-00137
Species name : Escherichia coli strain BE41 /Escherichia coli strain CX12(99.52%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :TGGTGCGGGAATTAACCCAACATTTCACGACACGAGCTGACGACAACCATGCACCACCTGTCACTTTGCCCCCGAAGGGGAAGCTCTATCTCTGGAAGGTTCAAAGGATGTCAAGACCCGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTTCCCCAGGCGGAGTGCTTAATGCGTTAGCTGCAGAAGGAAGGGCGGAAACCCTCCAACACTTAGCAATCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAGCGTCAGTTACAGACCAGAGAGCCGCCTTCGCCACCTGGTGTTCCTCCAAATATCTACGCATTTCACCGCTACACATGGAATTCCACTCTCCTCTTCTGCACTCAAGTCTCCCAGTTTCCAATGACCCTCCCCGGTTGAGCCGGGGGATTTCACATCAAACTTAAAAAACCGCCTGCGCTCCGTTTACCCCCAATAAATCCAGACA

JBE8-00137

$400.00Price