Product Name : JBE6-00104
Species name : Enterococcus avium strain 2324/Enterococcus avium strain 1842(99%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :GTGTGATCCATAATTATCCCCCTATCTCTAAGGGTATTTGTTTCCATGTCAAGGCCTGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATACTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACACTTGCGTGCATACTCCCCAGGCGGAGAACTTATTGCGTTAACTGCAGCACTGAATTCCTCCAACACTTAGTTCTCATCGTTTACGGCGTGGACTACTAGGGTATCTAATCCTATTTGCTCCCCACGCTTTCGTGCCTCAGTGTCAGTTACAGACCAGGCGACCGCCTTCGCCACTGGTGTTCCTCCATATATCTACGCATTTTACCGCTACACATGGAATTCCATCGCCCTCTTCTGCACTCCAGCATACCAGTTTCCATAGCTTACAATGGTTGAGCCATTGCCTTTTACTACAGACTTAGTACGCCACCTACGCACCCTTTACGCCCAATGATTCCGGATAACGCTTGCCACCTACGTATTAC

JBE6-00104

$400.00Price