Product Name : JBB4-02705
Species name : Uncultured organism clone ELU0025-T109-S-NIPCRAMgANa_000535/ Bacteroides vulgatus strain ADE11(100%)
Species/Strain : Strain
Phylum : Uncultured
Sequence :GTGGCACTTAAGCCGACACCTCACGGCACGAGCTGACGACAACCATGCAGCACCTTCACAGATGCCTTGCGGCTTACGGCTTTCACCGTAATTCATCTGCAATTTAAGCCCGGGTAAGGTTCCTCGCGTATCATCGAATTAAACCACATGTTCCTCCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCACCGTTGCCGGCGTACTCCCCAGGTGGAATACTTAACGCTTTCGCTTGGCCGCTTGCTGTATATCGCAAACAGCGAGTATTCATCGTTTACCGTGTGGACTACCAGGGTATCTAATCCTGTTTGATACCCACACTTTCGAGCCTCAATGTCAGTTGCAGCTTAGCAGGCTGCCTTCGCAATCGGAGTTCTTCGTGATATCTAAGCATTTCACCGCTACACCACGAATTCCGCCTGCCTCAACTGCACTCAAGATATCCAGTATCAACTGCAATTTTACGGTTGAGCCGCAAACTTTCACAACTGACTTAAACATCCATCTACGCTCCCTTTAAACCCAATAAATCCGGATAACGCTCGGATCCTCCGTATTACCGCGGCGGGC

JBB4-02705

$400.00Price