Product Name : JBE12-00101
Species name : Exiguobacterium acetylicum strain OsEp_Plm_15P3/Exiguobacterium acetylicum strain SN_6 (99.49%)
Species/Strain : Species
Phylum : Fermicutes
Sequence :CCAGGCCACCGCGGTAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCCTTTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGCCATTGGAAACTGGAAGGCTTGAGTACAGAAGAGAAGAGTGGAATTCCACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAAGGCGACTCTTTGGTCTGTAACTGACGCTGAGGCGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAGGTGTTGGGGGGTTTCCGCCCCTCAGTGCTGAAGCTAACGCATTAAGCACTCCGCCTGGGGAGTACGGCCGCAAGGCTGAAACTCAAAGGAATTGACGGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAACCTTACCAACTCTTGACATCCCATTGACCGCTTGAGAGATCAAGTTTTCCCTTCGGGGACAATGGTGACAGGTGGTGCATGGTTGTCGTCAGCTCCGTGTCGTGAGATGTTGGGTTAAGTCCCGCAACGAGGGGCAACC

JBE12-00101

$400.00Price