Product Name : JBE6-00615
Species name : Enterococcus faecium strain HBUAS9-4/Enterococcus faecium strain CE_8_3(100%)
Species/Strain : Strain
Phylum : Firmicutes
Sequence :TGGTGCGGGAATTAACCCAACATTTCACGACACGAGCTGACGACAACCATGCACCACCTGTCACTTTGCCCCCGAAGGGGAAGCTCTATCTCTGGAAGGTTCAAAGGATGTCAAGACCCGGTAAGGTTCTTCGCGTTGCTTCGAATTAAACCACATGCTCCACCGCTTGTGCGGGCCCCCGTCAATTCCTTTGAGTTTCAACCTTGCGGTCGTACTTCCCCAGGCGGAGTGCTTAATGCGTTAGCTGCAGAAGGAAGGGCGGAAACCCTCCAACACTTAGCAATCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTCCCCACGCTTTCGAGCCTCAGCGTCAGTTACAGACCAGAGAGCCGCCTTCGCCACCTGGTGTTCCTCCAAATATCTACGCATTTCACCGCTACACATGGAATTCCACTCTCCTCTTCTGCACTCAAGTCTCCCAGTTTCCAATGACCCTCCCCGGTTGAGCCGGGGGATTTCACATCAAACTTAAAAAACCGCCTGCGCTCCGTTTACCCCCAATAAATCCAGACA

JBE6-00615

$400.00Price