Product Name : JBE1-00109
Species name : Edwardsiella tarda ATCC 15947 = NBRC 105688 strain ATCC 15947/Edwardsiella tarda strain FDAARGOS_1473 (99.89%)
Species/Strain : Strain
Phylum : Proteobacteria
Sequence :AACACATGCAAGTCGAGCGGTAGCAGGGAGAAAGCTTGCTTTCTTCGCTGACGAGCGGCGGACGGGTGAGTAATGTCTGGGGATCTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGTGGGGGACCTTCGGGCCTCATGCCATCAGATGAACCCAGATGGGATTAGCTAGTAGGTGAGGTAATGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGTAGGGAGGAAGGTGTGCGTGTTAATAGCACGTACAATTGACGTTACCTACAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATCCAAGACTGGCAAGCTAGAGTCTCGTAGAGGGAGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCTCCTGGACGAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGTCGATTTGGAGGTTGTGCCCTTGAGGCGTGGCTTCCGAAGCTAACGCGTTAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGT

JBE1-00109

$400.00Price