Product Name : JBE1-00101
Species name : Edwardsiella tarda strain Gol7 /Edwardsiella anguillarum strain ALM28(100%)
Species/Strain : Species
Phylum : Proteobacteria
Sequence :CGCACGCAGGCGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATCCAAGACTGGCAAGCTAGAGTCTCGTAGAGGGAGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCTCCTGGACGAAGACTGACGCTCAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCTGTAAACGATGTCGATTTGGAGGTTGTGCCCTTGAGGCGTGGCTTCCGAAGCTAACGCGTTAAATCGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAGCGAATCCTGTAGAGATACGGGAGTGCCTTCGGGAACGCTGAGACAGGTGCTGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAAC

JBE1-00101

$400.00Price