Product Name : JBC9-00101
Species name : Cetobacterium somerae strain CBA7533/Uncultured bacterium clone C-clone81 (100%)
Species/Strain : Species
Phylum : Fusobacteria
Sequence :GATTCGATTTACCTTCGGGTATTGAGGATGGCGGACGGGTGAGTAACGCGTAAGGAACTTGCCTCTTGGTCTGGGACAACTGTTGGAAACGACAGCTAATACCGGATATTATGAGATTCTCGCATGGGAAACTTATGAAAGCTATATGCGCCAAGAGAGAGCCTTGCGTTCCATTAGCTAGTTGGTGGGGTAACGGCCCACCAAGGCGACGATGGATAGCCGGCCTGAGAGGGTGAACGGCCACAAGGGGACTGAGACACGGCCCTTACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCCACAAGCCTGATCCAGCAATTCTGTGTGCACGATGAAGGTCTTCGGATTGTAAAGTGCTTTCAGTTGGGAAGAAGAAAGTGACGGTACCAACAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGCGGTAATACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGAAAAATAAGTCTGATGTTAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGTTTTTCTAGAGTACTGGAGAGGTGGGCGGAACTACAAGTGTAGAGGTGAAA

JBC9-00101

$400.00Price